Top » Catalog » J2 » PF7357

$18.00

PF7357
[PF7357]

PF7357
hg38 Position: ChrY:12664201..12664201
Ancestral: C
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF7357_F GCCTTAGCCTCCGGAGTAC
Reverse Primer: PF7357_R ACCGTGGTACCTTATGATCTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y22040
1 x FGC20423
1 x Y7008
1 x Y15174
1 x SK1321
$90.00
Haplogroup Info
Other products
Currencies