Top » Catalog » J2 » FGC21093

$18.00

FGC21093
[FGC21093]

FGC21093
hg38 Position: ChrY:19154429..19154429
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below L25 > L70 > CTS6061 > PF5456
Forward Primer: FGC21093_F GGAGGAAATAAGCCCTGGTC
Reverse Primer: FGC21093_R AGGTTGCAAAGGAAAGCAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PF5132
1 x PF5351
1 x A16352
1 x ALK669
1 x CTS10662
1 x A17950
1 x PF5413
1 x S25258
1 x FGC29946
1 x Y13671
1 x FGC34168
1 x A17943
1 x Y9399
1 x PAGES00028
1 x Y949
1 x PF7308
1 x Y13663
1 x A17906
1 x CTS1192
$342.00
Haplogroup Info
Other products
Currencies