Top » Catalog » J2 » Y12618

$18.00

Y12618
[Y12618]

Y12618
hg38 Position: ChrY:8834630..8834630
Ancestral: C
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: Y12618_F ATCAGCAGTGTTTTGATATTTGCAC
Reverse Primer: Y12618_R AATTGCAGCTATCAGGGGTGA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies