Top » Catalog » J2 » Y12618

$18.00

Y12618
[Y12618]

Y12618
hg38 Position: ChrY:8834630..8834630
Ancestral: C
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: Y12618_F ATCAGCAGTGTTTTGATATTTGCAC
Reverse Primer: Y12618_R AATTGCAGCTATCAGGGGTGA
Reviews

Customers who bought this product also purchased
M12
M12
Y16576
Y16576
Z6049
Z6049
Y12378
Y12378
Y51684
Y51684
L26
L26
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies