Top » Catalog » J2 » FGC5900

$18.00

FGC5900
[FGC5900]

FGC5900
hg38 Position: ChrY:7350615..7350615
Ancestral: A
Derived: G
Reference: Greg Magoon (FGC 2013)
ISOGG Haplogroup: J2 (not listed)
Comments: Found in a J2-L229 person
Forward Primer: FGC5900_F CAGCTGAATGTATTGACACAGG
Reverse Primer: FGC5900_R AAATGGAAATCAATGGGAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L271
1 x M4853
1 x PF7320
1 x SK1333
1 x A24026
1 x A17922
1 x PH2967
1 x S15439
1 x SK1360
1 x S7835.2
1 x A15071
$198.00
Haplogroup Info
Other products
Currencies