Top » Catalog » J2 » A23312

$18.00

A23312
[A23312]

A23312
hg38 Position: ChrY:8484822..8484822
Ancestral: T
Derived: G
Reference: YSEQ (2018)
ISOGG Haplogroup: J2
Comments: Z40068 > Y20569 > Y20307 > Y20306 > Y20319 > Y125345
Forward Primer: A23312_F CATGAGGGTTCCCTGAGTAGG
Reverse Primer: A23312_R GCTAGCTAAACACATTCCTTCATTG
Reviews

Customers who bought this product also purchased
A23313
A23313
A25433
A25433
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y16823
1 x Y3636
1 x L229
1 x Y12604
1 x B437
1 x SK1324
1 x A24015
1 x FGC20157
1 x BY32798
1 x FGC61400
1 x Y22076
1 x A25165
1 x Y13097
1 x A17063
1 x A16358
1 x PAGES00014
1 x Y25793
1 x FGC9961
1 x Y9404
1 x A19129
1 x FGC32723
$378.00
Haplogroup Info
Other products
Currencies