Top » Catalog » J2 » A23312

$18.00

A23312
[A23312]

A23312
hg38 Position: ChrY:8484822..8484822
Ancestral: T
Derived: G
Reference: YSEQ (2018)
ISOGG Haplogroup: J2
Comments: Z40068 > Y20569 > Y20307 > Y20306 > Y20319 > Y125345
Forward Primer: A23312_F CATGAGGGTTCCCTGAGTAGG
Reverse Primer: A23312_R GCTAGCTAAACACATTCCTTCATTG
Reviews

Customers who bought this product also purchased
A25433
A25433
A23313
A23313
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies