Top » Catalog » J2 » A23338

$18.00

A23338
[A23338]

A23338
hg38 Position: ChrY:13094100..13094100
Ancestral: C
Derived: G
Reference: Provyn (2018)
ISOGG Haplogroup: J2
Comments:
Forward Primer: A23338_F ACAGATTCCCTTGTATTGACCAC
Reverse Primer: A23338_R AATGACTTCGTAACTTTACCTCATCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies