Top » Catalog » J2 » L24

$18.00

L24
[L24]

L24
hg38 Position: ChrY:12165822..12165822
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J2a1h
Comments: .
Forward Primer: L24_F GAGAGAGAGACATTATATTTAGGGAAACAG
Reverse Primer: L24_R CTGAGGTCAAATCATACATGTTCCT
Reviews

Customers who bought this product also purchased
FGC15772
FGC15772
Z27932
Z27932
Z7515
Z7515
Z482
Z482
A14266
A14266
F15834
F15834
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies