Top » Catalog » J2 » L24

$18.00

L24
[L24]

L24
hg38 Position: ChrY:12165822..12165822
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J2a1h
Comments: .
Forward Primer: L24_F GAGAGAGAGACATTATATTTAGGGAAACAG
Reverse Primer: L24_R CTGAGGTCAAATCATACATGTTCCT
Reviews

Customers who bought this product also purchased
Y29713
Y29713
FGC32723
FGC32723
L363
L363
FGC9927
FGC9927
Z7706
Z7706
Y30061
Y30061
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19092
1 x Y16947
1 x SK1368
1 x A22313
1 x A24018
1 x S399
1 x Y16955
1 x Y16904
1 x Y12371
1 x PF4941
1 x FGC22278
1 x HU197
1 x FGC30368
1 x Y13620
1 x A11791
1 x HU213
1 x L254
1 x Y12588
$324.00
Haplogroup Info
Other products
Currencies