Top » Catalog » J2 » L25

$18.00

L25
[L25]

L25
hg38 Position: ChrY:17024942..17024942
Ancestral: T
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J2a1h2
Comments: Downstream L24
Forward Primer: L25_F GAAAACCCAAAAACAAACAAAAATAC
Reverse Primer: L25_R TTAATGATTGTGTTCATTCGCTTC
Reviews

Customers who bought this product also purchased
Z7706
Z7706
Y30061
Y30061
PF5197
PF5197
Y29713
Y29713
Z2222
Z2222
FGC32723
FGC32723
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y14434
1 x Y17408
1 x FGC30343
1 x PF5380
1 x FGC6738
1 x Y15169
1 x PF4275
1 x Y12622
1 x BY24003
1 x PF5294
1 x A19079
1 x FGC20254
1 x Y12594
1 x FGC32591
1 x M12
1 x A12503
1 x BY21723
1 x Y14701
1 x FGC9878
$342.00
Haplogroup Info
Other products
Currencies