Top » Catalog » J2 » A23495

$18.00

A23495
[A23495]

A23495
hg38 Position: ChrY:13533221..13533221
Ancestral: G
Derived: A
Reference: Karl Schrock (2018)
ISOGG Haplogroup: J2
Comments: Below Y125345
Forward Primer: A23495_F GCTGTTGAATTTTGTGAAAGTCC
Reverse Primer: A23495_R AAAAATAGAAAGTGAGGAAATCCTACCTAC
Reviews

Customers who bought this product also purchased
A23494
A23494
A22122
A22122
A23499
A23499
A23498
A23498
A23497
A23497
A23496
A23496
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY32028
1 x A23760
1 x FGC5911
1 x A16677
1 x Y2151
1 x Y17066
$108.00
Haplogroup Info
Other products
Currencies