Top » Catalog » J2 » A22122

$18.00

A22122
[A22122]

A22122
hg38 Position: ChrY:6193714..6193714
Ancestral: C
Derived: T
Reference: YSEQ (2018)
ISOGG Haplogroup: J2
Comments: PF5172 > FGC16096 > L433 > Z40068 > Y20566
Forward Primer: A22122_F GTGATGAAATACTATACATTTTAATATATCAAATAC
Reverse Primer: A22122_R ATTTGGGAAGGTCCAGAGATG
Reviews

Customers who bought this product also purchased
A23494
A23494
A23499
A23499
A23498
A23498
A23497
A23497
A23496
A23496
A23495
A23495
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y23094
1 x SK1363
1 x FGC33284
1 x A22133
1 x Y17023
1 x Y17029
1 x A24019
1 x SK1366
1 x A19164
1 x A457
1 x S25269
1 x FGC11596
1 x Y15188
1 x Y12580
1 x Y11202
1 x FGC21079
1 x FGC32711
$306.00
Haplogroup Info
Other products
Currencies