Top » Catalog » J2 » BY32788

$18.00

BY32788
[BY32788]

BY32788
hg38 Position: ChrY:13492130..13492130
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: BY32788_F AAAGGAGAGGCCTCTTTTGG
Reverse Primer: BY32788_R CACCCAGGCTGGAATACAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies