Top » Catalog » M » M83

$18.00

M83
[M83]

M83
hg38 Position: ChrY:19711401..19711401
Ancestral: C
Derived: T
Reference: Underhill et al. 2001
ISOGG Haplogroup: M1a2a1b
Comments: B9.Alu01 Below Y26301 peer ro SK1880
Forward Primer: M83v2_F AAAACTGAAGAGGCCAGGAAG
Reverse Primer: M83v2_R TAGCTGGGTCTACAGGTGTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS385
1 x DYS485
$24.95
Haplogroup Info
Other products
Currencies