Top » Catalog » M » Page93

$18.00

Page93
[Page93]

Page93
hg38 Position: ChrY:13369555..13369555
Ancestral: G
Derived: T
Reference: ISOGG index (2017)
ISOGG Haplogroup: M
Comments: Aka: S322
Forward Primer: Page93_F TGTGCAGGAAGGTTTTCTGTC
Reverse Primer: Page93_R TTTTGCTGTAATCTGAAACATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y26297
$18.00
Haplogroup Info
Other products
Currencies