Top » Catalog » M » M177

$18.00

M177
[M177]

M177
hg38 Position: ChrY:2790828..2790828
Ancestral: G
Derived: A
Reference: Hammer et al. 1998
ISOGG Haplogroup: M2a
Comments: Aka SRY9138
Forward Primer: M177v2_F TGTAAACATGCCTCTGGGTTC
Reverse Primer: M177v2_R ATTGCTTGTGGGCCTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies