Top » Catalog » N » A13146

$18.00

A13146
[A13146]

A13146
hg38 Position: ChrY:21839092..21839092
Ancestral: G
Derived: T
Reference: Andrei Shkiperov(2016)
ISOGG Haplogroup: N1c1a1a1b
Comments: N-Y24000 (Y5003+)
Forward Primer: A13146_F TTGCAGGGGGAGGTGAC
Reverse Primer: A13146_R ACCTGTCTTCTCTGTGGGATACA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y19455
$18.00
Haplogroup Info
Other products
Currencies