Top » Catalog » N » A23982

$18.00

A23982
[A23982]

A23982
hg38 Position: ChrY:15813427..15813427
Ancestral: T
Derived: A
Reference: Andrei Shkiperov (2019)
ISOGG Haplogroup: N1a1a1a1a1a2a1a2b
Comments: Downstream Y5003 > A17604
Forward Primer: A23982_F TGGGGTTCAGGGGCTG
Reverse Primer: A23982_R ATGACTACCTTTCATCTTCTGATATCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A22944
$18.00
Haplogroup Info
Other products
Currencies