Top » Catalog » N » BY125192

$18.00

BY125192
[BY125192]

BY125192
hg38 Position: ChrY:16865302..16865302
Ancestral: C
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: N
Comments: .
Forward Primer: BY125192_F CGTAGAATACTTTAAATACGTCCATACTTAAGTAG
Reverse Primer: BY125192_R AGCCTCAGCACCATCACTATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY15416
1 x Z27279
1 x BY7446
1 x BZ1548
1 x BY14150
1 x A11802
1 x Y12600
1 x BZ2242
$144.00
Haplogroup Info
Other products
Currencies