Top » Catalog » N » BY173713

$18.00

BY173713
[BY173713]

BY173713
hg38 Position: ChrY:14085971..14085971
Ancestral: T
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: N
Comments: .
Forward Primer: BY173713_F GCATGCATTTTTATAATCAAATAGAGTAGC
Reverse Primer: BY173713_R TCATGTTACAGTTGCACTCCTATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y4142
1 x MF36215
1 x FGC40060
1 x FGC13363
1 x A18435
$90.00
Haplogroup Info
Other products
Currencies