Top » Catalog » N » M2783

$18.00

M2783
[M2783]

M2783
hg38 Position: ChrY:10013074..10013074
Ancestral: A
Derived: G
Reference: Underhill et al.
ISOGG Haplogroup: N1c1a1a1a1a
Comments: Below VL29 > L550 > L1025
Forward Primer: M2783_F CATGGCTTTCCTGACTTCTGTTAC
Reverse Primer: M2783_R AATATCTGGATCAAATGCTTATCTTG
Reviews

Customers who bought this product also purchased
Y3669
Y3669
CTS657
CTS657
A18476
A18476
Y26750
Y26750
BY6024
BY6024
PH3662
PH3662
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies