Top » Catalog » N » FGC13512

$18.00

FGC13512
[FGC13512]

FGC13512
hg38 Position: ChrY:21096255..21096262
Ancestral: ins
Derived: del
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: N1c1a1a1a1a4a (not listed)
Comments: Below CTS8173
Forward Primer: FGC13512_F AAAGAAGGCACACATCTGGC
Reverse Primer: FGC13512_R CATTTTGATGGTTCTTCAGTGG
Reviews

Customers who bought this product also purchased
Y15922
Y15922
Z35238
Z35238
YFS195242
YFS195242
Y6075
Y6075
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y4142
1 x MF36215
1 x FGC40060
1 x FGC13363
1 x A18435
$90.00
Haplogroup Info
Other products
Currencies