Top » Catalog » N » YFS195242

$18.00

YFS195242
[YFS195242]

YFS195242
hg38 Position: ChrY:11978461..11978461
Ancestral: T
Derived: G
Reference: Yfull (2015)
ISOGG Haplogroup: N1c1a1a1a1a4a (not listed)
Comments: Below CTS8173
Forward Primer: YFS195242_F TGATGGACACTTAGCTGAATTCTG
Reverse Primer: YFS195242_R GCTGCTCTTGAACGTCTGG
Reviews

Customers who bought this product also purchased
Y17242
Y17242
Y15922
Y15922
Y6075
Y6075
Z35238
Z35238
FGC13512
FGC13512
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies