Top » Catalog » N » Y10931

$18.00

Y10931
[Y10931]

Y10931
hg38 Position: ChrY:8433340..8433340
Ancestral: T
Derived: A
Reference: Yfull (2015)
ISOGG Haplogroup: N1c (not listed)
Comments: Below VL29 > L550 > Y4338 > Y4339
Forward Primer: Y10931_F GACAGGGCCCTAGAAAAAGG
Reverse Primer: Y10931_R GAGTCACCATCTCACATATATGAAGAG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies