Top » Catalog » N » Y12103

$18.00

Y12103
[Y12103]

Y12103
hg38 Position: ChrY:14074050..14074050
Ancestral: A
Derived: G
Reference: Yfull (2015)
ISOGG Haplogroup: N1c (not listed)
Comments: Below VL29 > L550 > Y4338 > Y4339
Forward Primer: Y12103_F AGACATCCCCGCCTTTCTC
Reverse Primer: Y12103_R GAGACTGTTGTGATTATTAGATACGACTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC36044
1 x A6248
1 x BY4620
1 x Y15173
1 x FGC5918
1 x A12431
$108.00
Haplogroup Info
Other products
Currencies