Top » Catalog » N » Y14116

$18.00

Y14116
[Y14116]

Y14116
hg38 Position: ChrY:13579097..13579097
Ancestral: T
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: N1c (not listed)
Comments: Below VL29 > L550 > L1025 > M2783
Forward Primer: Y14116_F CAGCAGACTGCCTTTGAACTC
Reverse Primer: Y14116_R GGATATCCCATGCCAATGAC
Reviews

Customers who bought this product also purchased
Y5004
Y5004
Y5582
Y5582
Y24022
Y24022
L591
L591
Z16980
Z16980
L1025
L1025
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies