Top » Catalog » N » Y14116

$18.00

Y14116
[Y14116]

Y14116
hg38 Position: ChrY:13579097..13579097
Ancestral: T
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: N1c (not listed)
Comments: Below VL29 > L550 > L1025 > M2783
Forward Primer: Y14116_F CAGCAGACTGCCTTTGAACTC
Reverse Primer: Y14116_R GGATATCCCATGCCAATGAC
Reviews

Customers who bought this product also purchased
Y24022
Y24022
L591
L591
Y5004
Y5004
Y5582
Y5582
L551
L551
N1a-VL29 Panel
N1a-VL29 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies