Top » Catalog » N » Y15252

$18.00

Y15252
[Y15252]

Y15252
hg38 Position: ChrY:12030288..12030288
Ancestral: T
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: N1c (not listed)
Comments: Below VL29 > L550 > L1025 > M2783 > L551
Forward Primer: Y15252_F GTTTAGTTAAGCAAGGTACTGTGGG
Reverse Primer: Y15252_R GAGGCTGATATTCCCTCTTTTACAG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A15066
$18.00
Haplogroup Info
Other products
Currencies