Top » Catalog » N » Y15814

$18.00

Y15814
[Y15814]

Y15814
hg38 Position: ChrY:15640821..15640821
Ancestral: C
Derived: G
Reference: YFull (2015)
ISOGG Haplogroup: N1c (not listed)
Comments: Below VL29 > Y5004 > Y7297
Forward Primer: Y15814_F GGCAGATACTCAGCAGCTGG
Reverse Primer: Y15814_R AGGGGGAATGTATCTGTTTCCT
Reviews

Customers who bought this product also purchased
Y15812
Y15812
Y5005
Y5005
Y5004
Y5004
CTS9976
CTS9976
L550
L550
Y15615
Y15615
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies