Top » Catalog » N » Y6599

$18.00

Y6599
[Y6599]

Y6599
hg38 Position: ChrY:14281981..14281981
Ancestral: C
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: N1c (not listed)
Comments: Below L1022 > Y5005 > Y5003
Forward Primer: Y6599_F GAAGTAGGATTGCCCGGTTAC
Reverse Primer: Y6599_R TCTTTGATTGTCCCCAAAGG
Reviews

Customers who bought this product also purchased
Y5005
Y5005
Y24500
Y24500
L550
L550
Y18573
Y18573
Y5004
Y5004
Z35267
Z35267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies