Top » Catalog » N » Y6599

$18.00

Y6599
[Y6599]

Y6599
hg38 Position: ChrY:14281981..14281981
Ancestral: C
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: N1c (not listed)
Comments: Below L1022 > Y5005 > Y5003
Forward Primer: Y6599_F GAAGTAGGATTGCCCGGTTAC
Reverse Primer: Y6599_R TCTTTGATTGTCCCCAAAGG
Reviews

Customers who bought this product also purchased
Z35267
Z35267
N1a-VL29 Panel
N1a-VL29 Panel
Y16503
Y16503
Y5003
Y5003
BY6007
BY6007
Y5005
Y5005
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies