Top » Catalog » N » Z1930

$18.00

Z1930
[Z1930]

Z1930
hg38 Position: ChrY:13217466..13217466
Ancestral: C
Derived: G
Reference: Ray Banks (2012)
ISOGG Haplogroup: N1c (not listed)
Comments: Downstream L1026 > Z1936
Forward Primer: Z1930_F TTATGGTTCAACAGGGAATTGAG
Reverse Primer: Z1930_R TGTCAACACACCCAACTAACTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies