Top » Catalog » N » YFS446310

$18.00

YFS446310
[YFS446310]

YFS446310
hg38 Position: ChrY:14728446..14728446
Ancestral: G
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: N1c1a1a1a1a2a4b (not listed)
Comments: Below Y10756 > PH547 > Z35246
Forward Primer: YFS446310_F TCAGTAATGCAAAATAAATTGTATTCTTG
Reverse Primer: YFS446310_R ATTTCCTTCCTTTTTACAGATGAATAAC
Reviews

Customers who bought this product also purchased
YFS446318
YFS446318
YFS446332
YFS446332
YFS446312
YFS446312
YFS446330
YFS446330
YFS446307
YFS446307
YFS446329
YFS446329
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies