Top » Catalog » N » M6921

$18.00

M6921
[M6921]

M6921
hg38 Position: ChrY:12114806..12114806
Ancestral: G
Derived: A
Reference: Underhill et al.
ISOGG Haplogroup: N1 (not listed)
Comments: .
Forward Primer: M6921_F GCAAGTTATGTGGGATTCCAC
Reverse Primer: M6921_R CCTATTGTTAAAGTTGAGGAGCATC
Reviews

Customers who bought this product also purchased
Y5004
Y5004
VL70
VL70
N1a-VL29 Panel
N1a-VL29 Panel
Z16974
Z16974
M2783
M2783
Y13478
Y13478
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies