Top » Catalog » N » M6921

$18.00

M6921
[M6921]

M6921
hg38 Position: ChrY:12114806..12114806
Ancestral: G
Derived: A
Reference: Underhill et al.
ISOGG Haplogroup: N1 (not listed)
Comments: .
Forward Primer: M6921_F GCAAGTTATGTGGGATTCCAC
Reverse Primer: M6921_R CCTATTGTTAAAGTTGAGGAGCATC
Reviews

Customers who bought this product also purchased
Z16974
Z16974
M2783
M2783
Y13478
Y13478
L550
L550
Z16976
Z16976
CTS6904
CTS6904
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies