Top » Catalog » N » A11932

$18.00

A11932
[A11932]

A11932
hg38 Position: ChrY:19128052..19128052
Ancestral: G
Derived: A
Reference: Leon Kull (2016)
ISOGG Haplogroup: N
Comments: Downstream M9062
Forward Primer: A11932_F GTGGGGTTTCTACCAACCTG
Reverse Primer: A11932_R GCCAGAAAACTGAGGGTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY153064
1 x BY2100
1 x ALK377
1 x MF50714
1 x Y15175
1 x Y47697
1 x A11814
1 x ALK567
$144.00
Haplogroup Info
Other products
Currencies