Top » Catalog » N » A11933

$18.00

A11933
[A11933]

A11933
hg38 Position: ChrY:12801979..12801979
Ancestral: C
Derived: A
Reference: Leon Kull (2016)
ISOGG Haplogroup: N
Comments: Downstream M9062
Forward Primer: A11933_F TGACATTTGGGCAAAGAAGC
Reverse Primer: A11933_R GCTTGCCTCCTACAATCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC48145
1 x Y20624
1 x A19360
1 x Y4122
1 x Y19977
1 x BY804
1 x FGC50982
$126.00
Haplogroup Info
Other products
Currencies