Top » Catalog » N » A11936

$18.00

A11936
[A11936]

A11936
hg38 Position: ChrY:13679802..13679802
Ancestral: T
Derived: C
Reference: Leon Kull (2016)
ISOGG Haplogroup: N
Comments: Downstream M9062
Forward Primer: A11936_F GGCATGCATGTTTGTAGCAG
Reverse Primer: A11936_R ATTTTCCCCTGAGTCCTGAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y5319
$18.00
Haplogroup Info
Other products
Currencies