Top » Catalog » N » A11937

$18.00

A11937
[A11937]

A11937
hg38 Position: ChrY:13966953..13966953
Ancestral: A
Derived: G
Reference: Leon Kull (2016)
ISOGG Haplogroup: N
Comments: Downstream M9062
Forward Primer: A11937_F CAACCTCATCCCTGTCTGTG
Reverse Primer: A11937_R CAGTTGTTGATTTTGGACGTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies