Top » Catalog » N » Y24594

$18.00

Y24594
[Y24594]

Y24594
hg38 Position: ChrY:19333030..19333030
Ancestral: G
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: N1c (not listed)
Comments: Below Y10756 > PH547 > Y20623
Forward Primer: Y24594_F CCTTTTACCTTGTGCAATGAGG
Reverse Primer: Y24594_R CTATTGCACATGCCTTTGAGG
Reviews

Customers who bought this product also purchased
Y20623
Y20623
L550
L550
A13135
A13135
Y5004
Y5004
PH2196
PH2196
Y20621
Y20621
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC36044
1 x A6248
1 x BY4620
1 x Y15173
1 x FGC5918
1 x A12431
1 x FGC20864
$126.00
Haplogroup Info
Other products
Currencies