Top » Catalog » N » BY5999

$18.00

BY5999
[BY5999]

BY5999
hg38 Position: ChrY:22278434..22278434
Ancestral: C
Derived: G
Reference: FTDNA (2016)
ISOGG Haplogroup: N1c1a1a1b
Comments: Below VL29 > Y7300 > Y15812
Forward Primer: BY5999_F AAAGCAGACTGGGGGGAC
Reverse Primer: BY5999_R GAAGAAAGACTTCCATGAGGAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y3548
1 x Y5299
1 x A13641
$54.00
Haplogroup Info
Other products
Currencies