Top » Catalog » N » Y23179

$18.00

Y23179
[Y23179]

Y23179
hg38 Position: ChrY:9627677..9627677
Ancestral: C
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: N1c
Comments: Below VL29 > Y7300 > Y15812 > Y15615
Forward Primer: Y23179_F CTCCACTCGCCTCAAACTG
Reverse Primer: Y23179_R AAGAAAGAATAACAGTACTACACAAGGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A23491
1 x M2234
1 x A23880
1 x S6716
$72.00
Haplogroup Info
Other products
Currencies