Top » Catalog » N » A13135

$18.00

A13135
[A13135]

A13135
hg38 Position: ChrY:15805628..15805628
Ancestral: T
Derived: C
Reference: Andrei Shkiperov(2016)
ISOGG Haplogroup: N1c1a1a1b
Comments: Below VL29 > Y10756 > PH2196
Forward Primer: A13135_F TGACCTAGGTTCAGTGATTTTCATC
Reverse Primer: A13135_R CATTGCATAGATTTGTATAAGTAGGGC
Reviews

Customers who bought this product also purchased
BY32571
BY32571
A17277
A17277
Y10756
Y10756
M2783
M2783
Y24594
Y24594
Y20621
Y20621
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies