Top » Catalog » N » CTS3587

$18.00

CTS3587
[CTS3587]

CTS3587
hg38 Position: ChrY:12936793..12936793
Ancestral: G
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: N
Comments: Below Z19830
Forward Primer: CTS3587_F GGTCAAGCACAGAACTTCAGC
Reverse Primer: CTS3587_R TTGATTGTGTGGCACCTAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y16846
1 x MF24296
1 x ALK759
$54.00
Haplogroup Info
Other products
Currencies