Top » Catalog » N » Y22091

$18.00

Y22091
[Y22091]

Y22091
hg38 Position: ChrY:15987066..15987066
Ancestral: C
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: N1a (not listed)
Comments: Below CTS4329
Forward Primer: Y22091_F ATGTCTGGAGCAGGAGGAAG
Reverse Primer: Y22091_R CATGTGGGTGGTTTCTAATGG
Reviews

Customers who bought this product also purchased
Y31244
Y31244
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y19451
1 x A869
1 x FGC4278
1 x SK1512
$72.00
Haplogroup Info
Other products
Currencies