Top » Catalog » N » A17624

$18.00

A17624
[A17624]

A17624
hg38 Position: ChrY:13582487..13582487
Ancestral: A
Derived: G
Reference: YSEQ (2017)
ISOGG Haplogroup: N1a1a1a1a1a1a7a3~ (not listed)
Comments: Downstream of Y5611, equiv with Y31253.
Forward Primer: A17624_F CCATCATGGAGAAATCAATGG
Reverse Primer: A17624_R AGTGAATGGCTAGTGAAAATCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies