Top » Catalog » N » Y31645

$18.00

Y31645
[Y31645]

Y31645
hg38 Position: ChrY:14992999..14992999
Ancestral: C
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: N1a1a1a1a2a1a1a1a1a1a1a~ (not listed)
Comments: Below Z19832.
Forward Primer: Y31645_F TTGCCAAGTTGGTCATAGCC
Reverse Primer: Y31645_R CCCAGCTACATGGGAAGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY20093
1 x Y6562
1 x BZ5
1 x Y22328
$72.00
Haplogroup Info
Other products
Currencies