Top » Catalog » N » Y22109

$18.00

Y22109
[Y22109]

Y22109
hg38 Position: ChrY:8797509..8797509
Ancestral: A
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: N1a1a1a1a2a1a1a2a~
Comments: Below Y23028 > Y23031
Forward Primer: Y22109_F TCATGAATGTGTTGTGTCTTCTTG
Reverse Primer: Y22109_R GATGTGCATGGTGGTGGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A16670
1 x Y16323
1 x Y31244
$54.00
Haplogroup Info
Other products
Currencies