Top » Catalog » N » CTS7324

$18.00

CTS7324
[CTS7324]

CTS7324
hg38 Position: ChrY:15309066..15309066
Ancestral: G
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: N1b1a1
Comments: Extracted from 1000 genomes data. Not qualified. Below Z4840 > Z8029.
Forward Primer: CTS7324_F TCGTTCTGTCACCCAAACTG
Reverse Primer: CTS7324_R CTCTCTTACCCTGGCAGGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies