Top » Catalog » N » Y28526

$18.00

Y28526
[Y28526]

Y28526
hg38 Position: ChrY:7726531..7726531
Ancestral: C
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: N1c
Comments: .
Forward Primer: Y28526_F AGGAGGTGCAGCATAGGAAG
Reverse Primer: Y28526_R TTCTTTACAGCAGGCCTTGG
Reviews

Customers who bought this product also purchased
CTS10760
CTS10760
F4134
F4134
N1c-CTS10760 Panel
N1c-CTS10760 Panel
A17886
A17886
Y32731
Y32731
Y28536
Y28536
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies