Top » Catalog » N » BY21942

$18.00

BY21942
[BY21942]

BY21942
hg38 Position: ChrY:2941843..2941843
Ancestral: A
Derived: G
Reference: FTDNA (2017)
ISOGG Haplogroup: N
Comments: .
Forward Primer: BY21942_F CCTCTGGAATAGCTGGGACTAC
Reverse Primer: BY21942_R ACAGTTTATATTGGCGGAGGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A15066
$18.00
Haplogroup Info
Other products
Currencies