Top » Catalog » N » A704

$18.00

A704
[A704]

A704
hg38 Position: ChrY:9583384..9583384
Ancestral: A
Derived: G
Reference: Bjorn Lamborn (2014)
ISOGG Haplogroup: N1c1a1a1a1 (not listed)
Comments: Below L1025. with Y4706
Forward Primer: A704_F CTCCATTATTGAATCCTTAAAACAGTAC
Reverse Primer: A704_R TAACCACAGTCAACATGCTATCTGT
Reviews

Customers who bought this product also purchased
A705
A705
A710
A710
A703
A703
A709
A709
A918
A918
A708
A708
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies