Top » Catalog » N » A709

$18.00

A709
[A709]

A709
hg38 Position: ChrY:21605185..21605185
Ancestral: G
Derived: A
Reference: Bjorn Lamborn (2014)
ISOGG Haplogroup: N1c1a1a1a1 (not listed)
Comments: Below L1025. with Y4706
Forward Primer: A709_F CTGGCTCATGTCTGCCTTC
Reverse Primer: A709_R AGCATTTCTCAGCCATGACC
Reviews

Customers who bought this product also purchased
A710
A710
A703
A703
A708
A708
A918
A918
A707
A707
A917
A917
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies