Top » Catalog » N » A711

$18.00

A711
[A711]

A711
hg38 Position: ChrY:8596838..8596838
Ancestral: G
Derived: A
Reference: Bjorn Lamborn (2014)
ISOGG Haplogroup: N1c1a1a1a1 (not listed)
Comments: Below L1025. with Y4706
Forward Primer: A711_F ATTGTAAGGGGGCACTCCTC
Reverse Primer: A711_R GCTAGATGACCAGCCAAAGC
Reviews

Customers who bought this product also purchased
A706
A706
A916
A916
A705
A705
A710
A710
A704
A704
A709
A709
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies