Top » Catalog » N » A917

$18.00

A917
[A917]

A917
hg38 Position: ChrY:15458558..15458558
Ancestral: T
Derived: C
Reference: Bjorn Lamborn (2014)
ISOGG Haplogroup: N1c1a1a1a1 (not listed)
Comments: Below L1025. with Y4706
Forward Primer: A917_F CCACCTGGAGTCTTAAGAATTCTG
Reverse Primer: A917_R AAGGGCATGTTACTAGAAAGCATAG
Reviews

Customers who bought this product also purchased
A707
A707
A916
A916
A706
A706
A711
A711
A705
A705
A710
A710
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y3197
1 x FGC17487
1 x A19606
1 x A11913
1 x CTS8428
$90.00
Haplogroup Info
Other products
Currencies